Page 2573 of 7802 [ 124820 posts ]  Go to page Previous  1 ... 2570, 2571, 2572, 2573, 2574, 2575, 2576 ... 7802  Next

kevinjh
Veteran
Veteran

Joined: 6 Nov 2011
Gender: Male
Posts: 8,456
Location: .

05 Dec 2011, 6:54 pm

Taupey wrote:
This is really cool Kevin. :)

The ASPERGERS sequence:
GATGCTTGCAAGAGGAGAAAGTCCTGAACGGTAG
The SYNDROME sequence:
GATGGATGAGGTAAATAGACAGTAATATTCTGTATAGTT

I wonder if there is a connection between Fibromyalgia(FMS) and Interstitial Cystitis(IC) and Aspergers Syndrome? My mother, has Fibromyalgia and we also believe that she has Aspergers. I have Fibromyalgia and Interstitial Cystitis with the Hunner ulceration in the Interstitial lining (Hunner Syndrome) and Aspergers Syndrome. My son has Interstitial Cystitis and Aspergers Syndrome. I asked this question to my new pain physician at the Eastern Virginia Medical School and he found it interesting and checked to see if there was research done on it but there hasn't been any done to see if there is a connection. I've seen others ask the same question.

I've been told that FMS and IC are on the same genetic marker.

It's just so annoying to cough like this.


The signature sequence is not literal. No protein encoding for (M)ASPERGERS, (M)LARGESPER, (M)DEVNRQ(O)YSV or (M)SYNDR(O)ME would have significant effects without being toxic. I just posted those sequences because they can form anagrams of themselves when reversed (especially with (M)ASPERGERS->(M)LARGESPER.

I'd like to thank the entertainment for this evening. Special interests are special for a reason, and those facts just gave me something to research. :D It does mean I will be unavailable for a few hours as I check the NCBI's site.

(If you have any interesting bits of information relating to genetics, please don't tell me about them until Thursday or Friday because they do have near-maximal distraction potential, and I would like to receive higher grades this semester. Until I upload my research to my site, it would be nice if there was some restraint in posting interesting things related to biochemistry.)



CockneyRebel
Veteran
Veteran

User avatar

Joined: 17 Jul 2004
Age: 51
Gender: Male
Posts: 121,237
Location: In my own little country

05 Dec 2011, 6:59 pm

I think that special interests are a good thing. :)


_________________
The Family Schlager


Sparx
Veteran
Veteran

Joined: 23 Oct 2011
Gender: Male
Posts: 2,186

05 Dec 2011, 7:04 pm

No one ever uses the chatroom, do they? Is it even functional?



kevinjh
Veteran
Veteran

Joined: 6 Nov 2011
Gender: Male
Posts: 8,456
Location: .

05 Dec 2011, 7:06 pm

CockneyRebel wrote:
I think that special interests are a good thing. :)


They're good for having fun, relaxing, and mental stimulation, but they do take a lot away from my schoolwork and college efforts.



MXH
Veteran
Veteran

User avatar

Joined: 28 Jul 2010
Age: 35
Gender: Male
Posts: 13,057
Location: Here i stand and face the rain

05 Dec 2011, 7:07 pm

Sparx wrote:
No one ever uses the chatroom, do they? Is it even functional?


The irc chatroom is pretty packed every night



Jory
Veteran
Veteran

Joined: 2 Jun 2011
Gender: Male
Posts: 17,520
Location: Tornado Alley

05 Dec 2011, 7:07 pm

Sparx wrote:
No one ever uses the chatroom, do they? Is it even functional?


I haven't used a chat room since 2001. They still exist?



iamnotaparakeet
Veteran
Veteran

User avatar

Joined: 31 Jul 2007
Age: 40
Gender: Male
Posts: 25,091
Location: 0.5 Galactic radius

05 Dec 2011, 9:06 pm

I'm may be surrounded by insanity, but I am not insane. You might be able to destroy my mind, but you can never change the fact I'm innocent - and that's what's driving you crazy!


[youtube]http://www.youtube.com/watch?v=-PdY__5lGGw[/youtube]



MakaylaTheAspie
Veteran
Veteran

User avatar

Joined: 21 Jun 2011
Age: 30
Gender: Non-binary
Posts: 14,565
Location: O'er the land of the so-called free and the home of the self-proclaimed brave. (Oregon)

05 Dec 2011, 10:36 pm

My head hurts. I think I will go to bed soon.


_________________
Hi there! Please refer to me as Moss. Unable to change my username to reflect that change. Have a nice day. <3


MXH
Veteran
Veteran

User avatar

Joined: 28 Jul 2010
Age: 35
Gender: Male
Posts: 13,057
Location: Here i stand and face the rain

05 Dec 2011, 10:48 pm

its snowing. havint seen the white crap since 07



CockneyRebel
Veteran
Veteran

User avatar

Joined: 17 Jul 2004
Age: 51
Gender: Male
Posts: 121,237
Location: In my own little country

05 Dec 2011, 11:45 pm

I just got back from a Christmas dinner with my friends. It was very fun. :)


_________________
The Family Schlager


kevinjh
Veteran
Veteran

Joined: 6 Nov 2011
Gender: Male
Posts: 8,456
Location: .

05 Dec 2011, 11:54 pm

CockneyRebel wrote:
I just got back from a Christmas dinner with my friends. It was very fun. :)


A Christmas dinner three weeks early? At least there is plenty of holiday cheer. :)



CockneyRebel
Veteran
Veteran

User avatar

Joined: 17 Jul 2004
Age: 51
Gender: Male
Posts: 121,237
Location: In my own little country

06 Dec 2011, 12:20 am

kevinjh wrote:
CockneyRebel wrote:
I just got back from a Christmas dinner with my friends. It was very fun. :)


A Christmas dinner three weeks early? At least there is plenty of holiday cheer. :)


It was wonderful. I've enjoyed myself. :)


_________________
The Family Schlager


theimperiousdork
Veteran
Veteran

User avatar

Joined: 7 Jul 2009
Age: 40
Gender: Male
Posts: 5,896
Location: Secret

06 Dec 2011, 1:07 am

Wow... Mick, that's nice! :)

I will be having my share, as this Saturday, my friends will be having our own party. At the coffee house, though; we'll be reserving an entire spot.


_________________
And now, the war resumes. Bring it on, you!


Circle989898
Veteran
Veteran

User avatar

Joined: 30 Oct 2011
Age: 37
Gender: Male
Posts: 1,955

06 Dec 2011, 1:23 am

http://en.wikipedia.org/wiki/Alice_in_W ... d_syndrome

Get the pun, click micropasia. It will occur quickly.



rabbitears
Veteran
Veteran

User avatar

Joined: 18 Jan 2011
Age: 34
Gender: Female
Posts: 6,398
Location: In a box of chocolate milk mix.

06 Dec 2011, 2:29 am

Seriously not looking forward to going to work today. :(


_________________
:albino: THINGS I LIKE :albino:
Parasaurolophus, Plesiosaurs, Dinosaurs, Pterosaurs, Music, Tuna, Chocolate milk, Oreos, Blue things

Parasaurolophuscolobus. Parasaurcolobus. Colobusaurolophus.
....And Nunchucks are my friends.


CockneyRebel
Veteran
Veteran

User avatar

Joined: 17 Jul 2004
Age: 51
Gender: Male
Posts: 121,237
Location: In my own little country

06 Dec 2011, 4:39 am

Wow! I was acting pretty nasty before I went to bed.


_________________
The Family Schlager