An answer for the other 80% of autism may have been found

Page 1 of 2 [ 27 posts ]  Go to page 1, 2  Next

carlos55
Veteran
Veteran

Joined: 5 Mar 2018
Gender: Male
Posts: 2,102

09 Dec 2024, 10:35 am

Interesting discovery, if likely true it means they have found the cause of 80% of autism, which i suspect includes most of us here including myself, even more interesting that in theory autism could be reversed with a simple therapy to correct this developed in the future.

Comes at the right time disproving any Trump vaccine conspiracy theories, if this mutation happens in the womb

https://english.elpais.com/science-tech ... ggaga.html

Quote:
The 24 DNA letters linked to autism: GCAAGGACATATGGGCGAAGGAGA
A team of Spanish scientists has discovered the mechanism that could explain a high percentage of autism spectrum disorders

Around one in 100 people live with an autism spectrum disorder, a developmental brain disorder characterized by difficulties in social interaction and unusual behavior patterns, such as an acute attention to detail. In only one in five cases is a significant genetic mutation detected. However, an international team of scientists, proposed a possible explanation for the remaining 80% of cases on Wednesday: the loss of a tiny segment of a protein essential for brain development. The genetic code for this fragment consists of just 24 chemical letters: GCAAGGACATATGGGCGAAGGAGA. The researchers — led by biochemist Raúl Méndez, 59, and biophysicist Xavier Salvatella, 52 —believe that these 24 letters could be key to reversing autism.

To understand this breakthrough, we must go back to the very beginning: the fertilized egg. This single cell contains a kind of instruction manual, DNA, made up of around 3 billion letters. Each letter represents the initial of a chemical compound — G, for example, stands for guanine (C₅H₅N₅O). This solitary cell will divide and multiply, eventually forming a person composed of about 30 trillion cells, each distinct despite sharing the same DNA — whether it’s a neuron in the brain, a myocyte in the muscles, or a melanocyte in the skin.


The key to this diversity lies in the fact that DNA functions like a piano, with each cell playing a different tune. In neurons, the CPEB4 protein acts as a conductor, regulating hundreds of genes essential for brain development. In 2018, Spanish researchers found that people with autism were missing a segment of this protein, linked to the 24 DNA letters. Their new study, published on Wednesday in Nature, reveals how the absence of this segment leads to the deregulation of 200 genes associated with autism spectrum disorders.

Biochemist Raúl Méndez, from the biomedical research institute IRB Barcelona, is an expert on CPEB4. “It is a protein that is synthesized and regulated in response to various types of stress,” explained the scientist during a press conference organized by Science Media Center Spain. “Our working hypothesis, which we have not yet proven 100%, is that during embryonic development some type of stress occurs that triggers this process of loss” of this crucial segment, explained Méndez. The Madrid-born biochemist points to possible causes, such as a chronic diet high in fat or a viral infection.

Fringe anti-vaccination movements have been linking autism to vaccines since 1998, when the discredited British doctor Andrew Wakefield published a fraudulent study that blamed the MMR vaccine for autism spectrum disorders. His conclusions, based on falsified data, have been debunked countless times. For instance, a study involving more than 500,000 children in Denmark found that autism rates were the same among vaccinated and unvaccinated children. “We do not want any anti-vaxxer to use our working hypothesis to question the effectiveness of vaccines,” Méndez emphasizes in a video conference with EL PAÍS.

Formation of solid aggregates of CPEB4 in experiments with purified proteins.
Formation of solid aggregates of CPEB4 in experiments with purified proteins.
IRB Barcelona
Cells use a code to read the 3 trillion letters of human DNA. Every set of three letters is the recipe for an amino acid, the building blocks of proteins, which are the tiny machines that perform most of the tasks in the human body. Méndez and Salvatella’s goal is to test, first in mice genetically modified to simulate autism, whether administering the eight amino acids encoded in the sequence GCAAGGACATATGGGCGAAGGAGA can reverse the disorder.

“We didn’t have a molecular description of what the eight amino acids missing in autism do,” says Salvatella, a 52-year-old researcher from Barcelona who also works at IRB Barcelona. The biophysicist explains that CPEB4 proteins tend to aggregate by the hundreds and form “liquid droplets” inside neurons. When there is neuronal stimulation, the droplets break up and release their contents. However, when those eight amino acids are missing in a large number of CPEB4 proteins, “those droplets basically become solids” that don’t function properly, triggering the deregulation of the 200 genes associated with autism.

The new research is part of the doctoral theses of Carla García Cabau and biophysicist Anna Bartomeu. “Now we need to find a way to reverse these effects, making the droplets liquid again,” as they are when the CPEB4 protein is complete, says Cabau, a 30-year-old researcher from Barcelona. The authors have observed that simply adding the eight missing amino acids is enough to restore the function of the droplets in experiments with purified proteins in the laboratory — a very preliminary but hopeful result.

The researchers are confident that the sequence GCAAGGACATATGGGCGAAGGAGA holds the key. “In the 2018 study, we saw that when these eight amino acids are missing, autism develops and the neuron doesn’t function properly, but we didn’t know why. Now, we understand the role of these eight amino acids in this protein,” explains Méndez. The biochemist is optimistic, even about the possibility of reversing autism’s effects in adults in the future. “In principle, there would be enough neuronal plasticity. In fact, when someone suffers a stroke, the rest of the brain often adapts to recover functions lost in the brain area that has died. More plasticity than that is impossible,” he argues.

The biologist Ana Kostic praises the new research, in which she was not involved. “The study is highly relevant as it elucidates molecular underpinnings of autism spectrum disorder and identifies potential therapeutic approaches,” says Kostic, Director of Drug Discovery and Development at the Seaver Autism Center for Research and Treatment in New York. “One can imagine that manipulating a 24-nucleotide fragment may lead to an improvement in the symptoms associated with idiopathic autism spectrum disorder; however, this hypothesis will need to be validated in preclinical models (as suggested by the authors) and then tested in clinical trials. It is difficult to predict the degree of benefit in different age groups, but it is possible that this approach would lead to an improvement even in adult individuals with autism spectrum disorder,” Kostic notes.

Sign up for our weekly newsletter to get more English-language news coverage from EL PAÍS USA Edition


_________________
"The reasonable man adapts himself to the world; the unreasonable one persists in trying to adapt the world to himself. Therefore all progress depends upon the unreasonable man."

- George Bernie Shaw


Double Retired
Veteran
Veteran

User avatar

Joined: 31 Jul 2020
Age: 70
Gender: Male
Posts: 6,808
Location: U.S.A.         (Mid-Atlantic)

09 Dec 2024, 11:31 am

I do not want a cure.

Comparing myself to my allistic siblings I think I'm better off with the Autism. Yes, they are ahead of me on socializing but I am ahead academically, professionally, and financially. And I did finally marry!


_________________
When diagnosed I bought champagne!
I finally knew why people were strange.


Ursula
Veteran
Veteran

User avatar

Joined: 23 Oct 2024
Age: 37
Gender: Female
Posts: 616
Location: South africa

09 Dec 2024, 11:55 am

Interesting, I've being on high protein diet lately, and it's helping with my fatigue. I'm reliant on strict diet as celiac or I may die soon,
I never really ate meat, or sufficient protein but don't think it's just all my supplements,

I as with many had very bad times where I'd eat not well, even binging on crisps, opting for sandwich
But wait for more info on possible research



autisticelders
Veteran
Veteran

User avatar

Joined: 23 Feb 2020
Gender: Female
Posts: 2,360
Location: Alpena MI

15 Dec 2024, 7:53 am

thanks so much for this post. fascinating stuff.


_________________
https://oldladywithautism.blog/

"Curiosity is one of the permanent and certain characteristics of a vigorous intellect.” Samuel Johnson


Miravlix
Emu Egg
Emu Egg

Joined: 8 Apr 2023
Age: 54
Gender: Male
Posts: 6

21 Dec 2024, 11:28 pm

This is unverified research! With zero peer review, not even a little positive or negative feedback from any external source.

The "cure" part is silly, he is using the "lie" that he can't rule out it will lead to a cure, but he has zero evidence for anything like that.

As far as I can tell the discovery is pointless, unless you are autistic and this stuff is your special interest (I find that really funny to point out). It's not going to do anything for anyone alive or future generation of people like us.



Velorum
Veteran
Veteran

User avatar

Joined: 11 Mar 2020
Age: 65
Gender: Non-binary
Posts: 1,363
Location: UK

22 Dec 2024, 4:36 am

More neurotypically driven dangerous nonsense.

Me, all of my AU family and friends do not regard ourselves as disordered or dysfunctional.

The thought of receiving some kind of treatment or therapy to convert me into a non Autistic person is the stuff of nightmares.

Not that I believe its possible of course, however this kind of thing perpetuates the medical model of our difference with all the negatives that this brings.


_________________
Diagnosed: ASD, hEDS, MCAS, ARFID
Retired specialist neurodevelopmental clinician
Member of Autistic & LGBTQ+ communities in South West UK
Trustee at Cornwall Pride charity & Coordinator at Kernow Neurodivergent Artists network


carlos55
Veteran
Veteran

Joined: 5 Mar 2018
Gender: Male
Posts: 2,102

22 Dec 2024, 2:17 pm

Not everyone is signed up to the ND movement Kool-Aid view that autism is a benevolent difference or that an official disorder in pathology & reality for many is some kind of "identity that needs protecting" (the biological disorder itself not the person) .

Others who think for themselves would welcome any treatment to improve their impairments.

My view like the COVID vaccines if you don't want curing or treating don't take it, its not like anyone is going to chase you down the street with a syringe, just live your life and don't concern yourself with the choices of others.

Back to the article

1. All nature publications are peer reviewed as far as i believe, it was a multi team/ multi national study anyway where risk of fraud is minimal

https://www.nature.com/nature-portfolio ... eer-review


3. Here`s the official research in Nature, i chose a simple article link as many people are put off from complex scientific articles and would prefer just a simple summary, but for those interested:-

https://www.nature.com/articles/s41586-024-08289-w

4. The study basically builds on 2018 research found here:-

https://www.irbbarcelona.org/en/news/di ... -of-autism

5. The 2024 IRB article

https://www.irbbarcelona.org/en/news/sc ... s-revealed

Maybe the Chinese will pick up on it, they seem to be actively researching autism too.


_________________
"The reasonable man adapts himself to the world; the unreasonable one persists in trying to adapt the world to himself. Therefore all progress depends upon the unreasonable man."

- George Bernie Shaw


Miravlix
Emu Egg
Emu Egg

Joined: 8 Apr 2023
Age: 54
Gender: Male
Posts: 6

22 Dec 2024, 2:42 pm

carlos55 wrote:
Others who think for themselves would welcome any treatment to improve their impairments.


Except you are not thinking for yourself, you're talking about killing a person to create another one, because you feel the other person is worthless. It's the same problem with StarTreks teleporter, it kills you to create a copy, except you are not copying when curing, we are talking replacing one person with another.


carlos55 wrote:
My view like the COVID vaccines if you don't want curing or treating don't take it, its not like anyone is going to chase you down the street with a syringe, just live your life and don't concern yourself with the choices of others.

And again you keep advocating for killing people, the point of vaccine's is also to protect those who can't handle being vaccinated. Vaccine's is not about the individual only.


Back to the article

carlos55 wrote:
1. All nature publications are peer reviewed as far as i believe, it was a multi team/ multi national study anyway where risk of fraud is minimal


Peer review would be that many groups of scientist replicate the test to see if they get the same result. This is a fundamental part of science a single study is WORTHLESS in science. We didn't all overnight convert to Einstein's nonsense (It was considered nonsense to begin with), until countless number of other scientist has figured out what he said was true and some of it took until this day to be verified 100 years for us to learn Einstein was right...



carlos55
Veteran
Veteran

Joined: 5 Mar 2018
Gender: Male
Posts: 2,102

23 Dec 2024, 2:07 am

Miravlix wrote:
carlos55 wrote:
Others who think for themselves would welcome any treatment to improve their impairments.


Except you are not thinking for yourself, you're talking about killing a person to create another one, because you feel the other person is worthless. It's the same problem with StarTreks teleporter, it kills you to create a copy, except you are not copying when curing, we are talking replacing one person with another.


carlos55 wrote:
My view like the COVID vaccines if you don't want curing or treating don't take it, its not like anyone is going to chase you down the street with a syringe, just live your life and don't concern yourself with the choices of others.

And again you keep advocating for killing people, the point of vaccine's is also to protect those who can't handle being vaccinated. Vaccine's is not about the individual only.


Back to the article

carlos55 wrote:
1. All nature publications are peer reviewed as far as i believe, it was a multi team/ multi national study anyway where risk of fraud is minimal


Peer review would be that many groups of scientist replicate the test to see if they get the same result. This is a fundamental part of science a single study is WORTHLESS in science. We didn't all overnight convert to Einstein's nonsense (It was considered nonsense to begin with), until countless number of other scientist has figured out what he said was true and some of it took until this day to be verified 100 years for us to learn Einstein was right...


Odd, I didn’t say anyone should be killed, I’m referring to an explanation and possible treatment, your putting words into my mouth here.

Please refrain from doing such things , in using extreme language and false assumptions in your replies.

The whole purpose of a "treatment" is to change something in a living person. The article states it allows possible avenues for treatment in autistic people

Quote:
. More specifically, our understanding of how reduced inclusion of me4 in CPEB4 generates a dominant-negative effect, and our observation that the normal activity of me4 can be restored in trans, opens up an opportunity to treat ASD on the basis of regulation of the dynamics of biomolecular assemblies by drug-like small molecules and peptides44.


I`m aware of the argument about aborting autistic babies. The thing ND movement advocates should be concerned about:-

It’s scientifically much more likely, many many times more likely that autism will be identified & prevented through early identification in the womb like down syndrome today.

A treatment for autism is an alternative for that mother that doesn’t want a child that’s possibly disabled as well as help for us if we want it, so ND advocates should be supporting research in treating existing autism.

Its really a matter of what’s first between Early identification in womb and prevention v Treatment, by being against treatment they are only shooting themselves in the foot allowing the other more likely option to eventually win.

Or

Maybe your referring to the old ND unproven and illogical argument that a treatment would "change" someone to the point that it is not the same person like a metaphorical brain transplant maybe?.

Its strange because if you are on the one hand you seem concerned about peer reviewed science,

But on the other willing to believe unproven illogical claims made by those on the internet who are not even scientists. :lol:


_________________
"The reasonable man adapts himself to the world; the unreasonable one persists in trying to adapt the world to himself. Therefore all progress depends upon the unreasonable man."

- George Bernie Shaw


kokopelli
Veteran
Veteran

User avatar

Joined: 27 Nov 2017
Gender: Male
Posts: 5,318
Location: amid the sunlight and the dust and the wind

23 Dec 2024, 2:44 am

A few remarks.

First, idiopathic autism refers to autism with no known cause -- i.e., no cause has been found. Whether or not those 80% of cases that are idiopathic autism all have the same cause remains to be seen.

Second, even if this finding is found to be true, that does not mean that a treatment is going to be available any time soon. I may be wrong, but that treatment could involve taking samples of the fetuses of women who have just been found to be pregnant to check the genes and then somehow modifying the genes to "fix" them.

Third, such genetic tests could result in women being informed that their baby will likely be autistic so that they can abort the baby before he or she is born.

Fourth, there are patterns in autism that would seem unlikely to be explained by this. For example, autism seems to be higher in more northern regions. If the genes in question here turn out to be involved, it might be possible that they are a factor that might be aggravated by other things like Vitamin D.

In other words, the research is still young and even if it pans out, it might not be a cause for celebration.



Gentleman Argentum
Veteran
Veteran

User avatar

Joined: 24 Aug 2019
Age: 55
Gender: Male
Posts: 1,019
Location: State of Euphoria

23 Dec 2024, 5:41 am

carlos55 wrote:
Interesting discovery, if likely true it means they have found the cause of 80% of autism, which i suspect includes most of us here including myself, even more interesting that in theory autism could be reversed with a simple therapy to correct this developed in the future.


I am skeptical, because the theory implies we should dislike Lady Gaga, and I have no opinion on her music.

I don't think that autism could be reversed easily even so, because birth is a special time when development occurs, and once that development has taken place, only modest changes occur thereafter.


_________________
My magical motto is Animus facit nobilem. I like to read fantasy and weird fiction. Just a few of my favorite online things: music, chess, and dungeon crawl stone soup.


kokopelli
Veteran
Veteran

User avatar

Joined: 27 Nov 2017
Gender: Male
Posts: 5,318
Location: amid the sunlight and the dust and the wind

23 Dec 2024, 5:57 am

Gentleman Argentum wrote:
carlos55 wrote:
Interesting discovery, if likely true it means they have found the cause of 80% of autism, which i suspect includes most of us here including myself, even more interesting that in theory autism could be reversed with a simple therapy to correct this developed in the future.


I am skeptical, because the theory implies we should dislike Lady Gaga, and I have no opinion on her music.

I don't think that autism could be reversed easily even so, because birth is a special time when development occurs, and once that development has taken place, only modest changes occur thereafter.


Exactly.

In particular, the brain is built before birth. For the genes to change the way the brain is built, the treatment would have to occur before the brain began. The earliest development of the brain should have started by the time that the pregnancy is usually confirmed. By the time the formation of the first layer of neurons begins, if you want to make genetic changes to affect the neuronal development, they had better of been made before that.



carlos55
Veteran
Veteran

Joined: 5 Mar 2018
Gender: Male
Posts: 2,102

23 Dec 2024, 7:56 am

kokopelli wrote:
Gentleman Argentum wrote:
carlos55 wrote:
Interesting discovery, if likely true it means they have found the cause of 80% of autism, which i suspect includes most of us here including myself, even more interesting that in theory autism could be reversed with a simple therapy to correct this developed in the future.


I am skeptical, because the theory implies we should dislike Lady Gaga, and I have no opinion on her music.

I don't think that autism could be reversed easily even so, because birth is a special time when development occurs, and once that development has taken place, only modest changes occur thereafter.


Exactly.

In particular, the brain is built before birth. For the genes to change the way the brain is built, the treatment would have to occur before the brain began. The earliest development of the brain should have started by the time that the pregnancy is usually confirmed. By the time the formation of the first layer of neurons begins, if you want to make genetic changes to affect the neuronal development, they had better of been made before that.


Sure maybe maybe not. The article said about potential treatment “working in trans” ( medical term not gender)

I assume from that they are referring to a stem cell like alteration where the potential treatment change cascades through to other calls ( I’m not referring to scam autism stem cell treatment here )

It’s just information anyway so there’s no need for extreme knee jerk language from others anyway about endorsing killing anyone, simply wanting relief from one’s own symptoms via potential treatment.


_________________
"The reasonable man adapts himself to the world; the unreasonable one persists in trying to adapt the world to himself. Therefore all progress depends upon the unreasonable man."

- George Bernie Shaw


MjrMajorMajor
Veteran
Veteran

User avatar

Joined: 15 Jan 2012
Gender: Female
Posts: 8,804

23 Dec 2024, 8:32 pm

I just skimmed the responses so my reply is not the most informed.
Any aids for autistic symptoms does not erase who we are, anymore than a cochlear implant erased deafness.
I know some deaf people rejected the above due to a feared loss of identity, but some magic pill which might reduce some social deficits would not change the kernel of who I am



carlos55
Veteran
Veteran

Joined: 5 Mar 2018
Gender: Male
Posts: 2,102

24 Dec 2024, 7:59 am

MjrMajorMajor wrote:
I just skimmed the responses so my reply is not the most informed.
Any aids for autistic symptoms does not erase who we are, anymore than a cochlear implant erased deafness.
I know some deaf people rejected the above due to a feared loss of identity, but some magic pill which might reduce some social deficits would not change the kernel of who I am


I’m not a neuroscientist but it is possible to use logic in the “it would fundamentally change the person to another person debate”

While some autisms end up changing the whole architecture of the brain they tend to lead to very serious profound disabilities.

Most gene mutations simply lead to the gene not functioning properly or at all.

The brain is very complex involving a chain of chemical processes to create a signal. A good example is GPI bio synthesis in the brain which is a linked multichain system of different processes all leading to a signal being produced

Each event in the chain is controlled by a PIG gene, like PIGV or PIGW there are many disorders of the PIG gene causing a break in the chain leading to symptoms like ID and autism.

A treatment would fix the breaks in the chain.

An analogy of an autism therapy would be removing blocks from a highway allowing smoother flow of traffic. The roads would be in the same place but everything would flow faster and more efficiently.

You would still be the same person just a better version of yourself


_________________
"The reasonable man adapts himself to the world; the unreasonable one persists in trying to adapt the world to himself. Therefore all progress depends upon the unreasonable man."

- George Bernie Shaw


carlos55
Veteran
Veteran

Joined: 5 Mar 2018
Gender: Male
Posts: 2,102

24 Dec 2024, 4:18 pm

https://www.researchgate.net/figure/The ... _325173962


_________________
"The reasonable man adapts himself to the world; the unreasonable one persists in trying to adapt the world to himself. Therefore all progress depends upon the unreasonable man."

- George Bernie Shaw